View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4291-Insertion-63 (Length: 147)
Name: NF4291-Insertion-63
Description: NF4291
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4291-Insertion-63 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 98; Significance: 1e-48; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 98; E-Value: 1e-48
Query Start/End: Original strand, 1 - 147
Target Start/End: Complemental strand, 45745002 - 45744854
Alignment:
| Q |
1 |
ttaggtcccctttt-aaccgctgatattaatggtactcgatttgtgagacctaagctctttctttcttttccctttgtaaccaa-aaaacaatgt-aagt |
97 |
Q |
| |
|
|||||||||||||| |||||||||| ||||||||||||| |||||||||||| | ||||||||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
45745002 |
ttaggtcccctttttaaccgctgatgttaatggtactcggtttgtgagacctcacctctttctttcttttccctttgtaaccaaaaaaacaatgtcaagt |
45744903 |
T |
|
| Q |
98 |
aacgcacaagttgtattaaactaaagaacaaaaaataggtgcatgaatca |
147 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
45744902 |
aatgcacaagttgtattaaactaaagaacaaaaaat-ggtgcatgaatca |
45744854 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 39; Significance: 0.0000000000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 39; E-Value: 0.0000000000002
Query Start/End: Original strand, 1 - 79
Target Start/End: Original strand, 38416850 - 38416928
Alignment:
| Q |
1 |
ttaggtccccttttaaccgctgatattaatggtactcgatttgtgagacctaagctctttctttcttttccctttgtaa |
79 |
Q |
| |
|
|||||||| ||||||| ||||||| || |||| ||||||||||||||||| ||||||||||| ||||||||| |||| |
|
|
| T |
38416850 |
ttaggtcctcttttaatcgctgatgctagtggtgctcgatttgtgagaccttagctctttcttctttttcccttagtaa |
38416928 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 36; Significance: 0.00000000001; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 36; E-Value: 0.00000000001
Query Start/End: Original strand, 1 - 87
Target Start/End: Original strand, 24082677 - 24082764
Alignment:
| Q |
1 |
ttaggtccccttttaaccgctgatattaatggtactcgatttgtgagacctaagctctttcttt-cttttccctttgtaaccaaaaaa |
87 |
Q |
| |
|
||||| |||||||||| |||||| |||||||||||| |||||||||||| || | ||| ||| ||||| ||||||||||||||||| |
|
|
| T |
24082677 |
ttaggcccccttttaattgctgatgctaatggtactcggtttgtgagaccttagttttttttttcctttttcctttgtaaccaaaaaa |
24082764 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 31374266 - 31374218
Alignment:
| Q |
1 |
ttaggtccccttttaaccgctgatattaatggtactcgatttgtgagac |
49 |
Q |
| |
|
||||| |||||||||| | ||||| ||||||||||||||||||||||| |
|
|
| T |
31374266 |
ttaggcccccttttaattgttgatactaatggtactcgatttgtgagac |
31374218 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University