View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4291-Insertion-64 (Length: 204)
Name: NF4291-Insertion-64
Description: NF4291
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4291-Insertion-64 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 10 - 204
Target Start/End: Complemental strand, 53682262 - 53682068
Alignment:
| Q |
10 |
cttaggatacttagcacctgagtatgctatgtggggaaaagtttctgaaagctgtgatgtctatagttttggaattcttctattagagctagtaactggt |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53682262 |
cttaggatacttagcacctgagtatgctatgtggggaaaagtttctgaaagctgtgatgtctatagttttggaattcttctattagagctagtaactggt |
53682163 |
T |
|
| Q |
110 |
agaaagcccatagagaagttacctggtgggcttaagagaacaataactgaatgggctgagcctttgataaccaaaggaaggtttagggatatggt |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53682162 |
agaaagcccatagagaagttacctggtgggcttaagagaacaataactgaatgggctgagcctttgataaccaaaggaaggtttagggatatggt |
53682068 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 23 - 85
Target Start/End: Complemental strand, 46146004 - 46145942
Alignment:
| Q |
23 |
gcacctgagtatgctatgtggggaaaagtttctgaaagctgtgatgtctatagttttggaatt |
85 |
Q |
| |
|
||||| || |||||||||||||| || |||||||| || |||||||| ||||| ||||||||| |
|
|
| T |
46146004 |
gcaccagaatatgctatgtggggtaaggtttctgagagttgtgatgtttatagctttggaatt |
46145942 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University