View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4291-Insertion-68 (Length: 116)
Name: NF4291-Insertion-68
Description: NF4291
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4291-Insertion-68 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 101; Significance: 2e-50; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 101; E-Value: 2e-50
Query Start/End: Original strand, 12 - 116
Target Start/End: Original strand, 40970336 - 40970440
Alignment:
| Q |
12 |
attgcaataagttggctaattcacgaccaattttacgttgttcgataattgggggaatgcgtggttcaagaaattgatgtaacagagtggagaagtgcaa |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40970336 |
attgcaataagttggctaattcacgaccaattttacgttgttcgataattgggggaatgcgtggttcaagaaattgatgtaacagagtggagaagtgcaa |
40970435 |
T |
|
| Q |
112 |
agttt |
116 |
Q |
| |
|
|||| |
|
|
| T |
40970436 |
cgttt |
40970440 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University