View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4291-Insertion-71 (Length: 201)
Name: NF4291-Insertion-71
Description: NF4291
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4291-Insertion-71 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 173; Significance: 3e-93; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 17 - 201
Target Start/End: Complemental strand, 47248395 - 47248211
Alignment:
| Q |
17 |
aaaaacatacataagtctactgcatcagtttatatgacgatgtttgggatagactttgcaaagttcacaaattttggtgtaataatttttgcgggaggtc |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47248395 |
aaaaacatacataagtctactgcatcagtttatatgacgatgtttgggagagactttgcaaagttcacaaattttggtgtaataatttttgcgggaggtc |
47248296 |
T |
|
| Q |
117 |
tatatcggcttatataattttgttggaaaatgttgaagaatctcaattatatgagaggtgaccggaacaccgttgaagtatcaga |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
47248295 |
tatatcggcttatataattttgttggaaaatgttgaagaatctcaattatatgagaggtgatcggaacaccgttgaagtgtcaga |
47248211 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University