View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4291-Insertion-81 (Length: 110)
Name: NF4291-Insertion-81
Description: NF4291
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4291-Insertion-81 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 106; Significance: 1e-53; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 106; E-Value: 1e-53
Query Start/End: Original strand, 1 - 110
Target Start/End: Original strand, 2740356 - 2740465
Alignment:
| Q |
1 |
ttttctagttaaagaaaggtttcaagatttatgtggtgagttcgagattcagttgaagtttgcatcggttgaacatccccaaacaaatgtgaaatttgaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2740356 |
ttttctagttaaagaaaggtttcaagatttatgtggtgagttcaagattcagttgaagtttgcatcggttgaacatccccaaacaaatgtgaaatttgaa |
2740455 |
T |
 |
| Q |
101 |
taggcaaaca |
110 |
Q |
| |
|
|||||||||| |
|
|
| T |
2740456 |
taggcaaaca |
2740465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University