View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4291-Insertion-86 (Length: 168)
Name: NF4291-Insertion-86
Description: NF4291
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4291-Insertion-86 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 83; Significance: 1e-39; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 83; E-Value: 1e-39
Query Start/End: Original strand, 43 - 149
Target Start/End: Complemental strand, 4136847 - 4136741
Alignment:
| Q |
43 |
ttgtagcaatttgatgctggtgggaacttattacaacgagtgagtactaaactttctgttagctcttatggggaagatgaactcatgagtctcattcaat |
142 |
Q |
| |
|
|||||||||||||||||||| ||||| | || ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4136847 |
ttgtagcaatttgatgctggcgggaatctgttgcaacgagtgagtactaagctttctgttagctcttatggggaagatgaactcatgagtctcattcaat |
4136748 |
T |
|
| Q |
143 |
cgtaagt |
149 |
Q |
| |
|
||||||| |
|
|
| T |
4136747 |
cgtaagt |
4136741 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University