View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4291-Insertion-87 (Length: 83)
Name: NF4291-Insertion-87
Description: NF4291
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4291-Insertion-87 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 66; Significance: 8e-30; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 66; E-Value: 8e-30
Query Start/End: Original strand, 1 - 83
Target Start/End: Complemental strand, 23122676 - 23122588
Alignment:
| Q |
1 |
taaagttgataattattctctcac------tatggtgttcatgaaagtttgttggatggattattgtttatgtataaattatgttgtaa |
83 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23122676 |
taaagttgataattattctctcacctatgctatggtgttcatgaaagtttgttggatggattattgtttatgtataaattatgttgtaa |
23122588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University