View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4291-Insertion-9 (Length: 88)
Name: NF4291-Insertion-9
Description: NF4291
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4291-Insertion-9 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 58; Significance: 5e-25; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 58; E-Value: 5e-25
Query Start/End: Original strand, 7 - 88
Target Start/End: Complemental strand, 43596869 - 43596790
Alignment:
| Q |
7 |
tttttaacatcaacttttttcttatgatatactacatcccaaattttacggttgaatatgactcgtgcgtcgcacgggttga |
88 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||| |
|
|
| T |
43596869 |
tttttaacatcaacttttttct-atgatatactacatcccaaattttacgg-ggaatatgacccgtgcgtcgcacgggttga |
43596790 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 41; Significance: 0.000000000000007; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 41; E-Value: 0.000000000000007
Query Start/End: Original strand, 7 - 55
Target Start/End: Complemental strand, 14833245 - 14833198
Alignment:
| Q |
7 |
tttttaacatcaacttttttcttatgatatactacatcccaaattttac |
55 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
14833245 |
tttttaacatcaacttttttct-atgatatactacatcccaaattttac |
14833198 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University