View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4291_high_10 (Length: 249)
Name: NF4291_high_10
Description: NF4291
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4291_high_10 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 15 - 231
Target Start/End: Complemental strand, 1905786 - 1905570
Alignment:
| Q |
15 |
tcatcacctgatctttcctccctttcccacggtgaaccaccaaccctcatggataatttggttcaagtatgcttcacagaagacaaattaagcataaatc |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1905786 |
tcatcacctgatctttcctccctttcccacggtgaaccaccaaccctcatggataatttggttcaagtatgcttcacagaagacaaattaagcataaatc |
1905687 |
T |
 |
| Q |
115 |
ataatgtactgcatgtatttccagaattcttgtagtaaaatattggtccgggaacaagcattaatttacttgcgttttagctatccttaatcctttgatt |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1905686 |
ataatgtactgcatgtatttccagaattcttgtagtaaaatattggtccgggaacaagcattaatttacttgcgttttagctatccttaatcctttgatt |
1905587 |
T |
 |
| Q |
215 |
gggggaatgagccatct |
231 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
1905586 |
gggggaatgagccatct |
1905570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University