View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4291_low_12 (Length: 296)
Name: NF4291_low_12
Description: NF4291
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4291_low_12 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 180; Significance: 3e-97; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 52 - 279
Target Start/End: Original strand, 8385005 - 8385232
Alignment:
| Q |
52 |
tacatgtatctggtctaaatgtgacctatgaccaaatacatgtacttttggcctagatatacgtaattttttgcttatatttcattccagtatggtggaa |
151 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||| ||||| ||| |
|
|
| T |
8385005 |
tacatgtatctgatctaaatgtgacctatgaccaaatacatgtacttttggtctagatgtacgtaattttttgcttatatttcattccagaatggttgaa |
8385104 |
T |
 |
| Q |
152 |
tatctgtctacctatcaacgtttataagtcataaatgatttgagtgaaaagtagataatgtgaacaaactaactattaatatttgtcgttnnnnnnnntg |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| || |
|
|
| T |
8385105 |
tatctgtctacctatcaacgtttataagtcataaatgatttgagtgaaaagtaaataatgtgaacaaactaactattaatatttgtcgttaaaaaaaatg |
8385204 |
T |
 |
| Q |
252 |
ttacctgattggttatggcggaacttat |
279 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
8385205 |
ttacctgattggttatggcggaacttat |
8385232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 1 - 41
Target Start/End: Original strand, 8384919 - 8384959
Alignment:
| Q |
1 |
tgattagagactaaaactactccctctgtaacaaaatataa |
41 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
8384919 |
tgatgagagactaaaactactccctctgtaacaaaatataa |
8384959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University