View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4291_low_15 (Length: 243)
Name: NF4291_low_15
Description: NF4291
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4291_low_15 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 122; Significance: 1e-62; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 13 - 180
Target Start/End: Complemental strand, 11055682 - 11055518
Alignment:
| Q |
13 |
aaaattgtggaaagcatccattatgtgcagagtatgaatagtatcaacataattttccgaattcaccgtgttaccagcaatggttaataagattataaag |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| || ||||||||||||| |||||||||||||| || |||||||||||| |||||||||| |
|
|
| T |
11055682 |
aaaattgtggaaagcatccattatgtgcagagtatgaacagcatcaacataatttgtcgaattcaccgtgtaacaagcaatggttaa---gattataaag |
11055586 |
T |
 |
| Q |
113 |
tagttcattatcattttgggttatgtttatattttagctgggtttattgcagattagtttccccagta |
180 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
11055585 |
tagttcattatcattttgggttatgtttatattgtagctgggtttatttcagattagtttccccagta |
11055518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University