View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4292-Insertion-6 (Length: 259)
Name: NF4292-Insertion-6
Description: NF4292
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4292-Insertion-6 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 88; Significance: 2e-42; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 6 - 93
Target Start/End: Complemental strand, 52712374 - 52712287
Alignment:
| Q |
6 |
cttgcttcctggcacggttttgctagacatttttgtgggcgtaatgtgtcgaaagaggccgacattgtcagcaaaaccatcccctgtg |
93 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52712374 |
cttgcttcctggcacggttttgctagacatttttgtgggcgtaatgtgtcgaaagaggccgacattgtcagcaaaaccatcccctgtg |
52712287 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 182 - 259
Target Start/End: Complemental strand, 52712198 - 52712121
Alignment:
| Q |
182 |
ctgaactctgtcaatttaatgcagtctatcctctgctagaattagttgaaaattgttaaagtggttacaatccttgta |
259 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52712198 |
ctgaactctgtcaatttaatgcagtccatcctctgctagaattagttgaaaattgttaaagtggttacaatccttgta |
52712121 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 186 - 259
Target Start/End: Complemental strand, 52721014 - 52720941
Alignment:
| Q |
186 |
actctgtcaatttaatgcagtctatcctctgctagaattagttgaaaattgttaaagtggttacaatccttgta |
259 |
Q |
| |
|
|||||||||| |||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52721014 |
actctgtcaagctaatgcagaccatcctctgctagaattagttgaaaattgttaaagtggttacaatccttgta |
52720941 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 6 - 93
Target Start/End: Complemental strand, 52721195 - 52721108
Alignment:
| Q |
6 |
cttgcttcctggcacggttttgctagacatttttgtgggcgtaatgtgtcgaaagaggccgacattgtcagcaaaaccatcccctgtg |
93 |
Q |
| |
|
||||| |||| ||| ||||| || |||||||| || ||||| | |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52721195 |
cttgcctccttgcatggtttcgccagacatttctgcgggcgcagtgtgtcgaaagaggccgacattgtcagcaaaaccatcccctgtg |
52721108 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University