View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4292_high_16 (Length: 217)
Name: NF4292_high_16
Description: NF4292
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4292_high_16 |
 |  |
|
| [»] scaffold0100 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0100 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: scaffold0100
Description:
Target: scaffold0100; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 36 - 209
Target Start/End: Complemental strand, 50898 - 50725
Alignment:
| Q |
36 |
atctcaaggtttcattcaaatgaagttcatgaagagcgaagaagctttagtcacaagcgtttcagagagatttctgttactaatgattcggatgaatctt |
135 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
50898 |
atctcaaggtttcattcaaatgaagttcatgaagagcgaagaagctttagtcacaatcgtttcagagagatttctgttactactgattcggatgaatctt |
50799 |
T |
 |
| Q |
136 |
cttcagctttctcttctcttctaatcaacggtggtgatgaatcttctgattcggatgtttctttcttctctgct |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50798 |
cttcagctttctcttctcttctaatcaacggtggtgatgaatcttctgattcggatgtttctttcttctctgct |
50725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University