View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4292_low_16 (Length: 272)
Name: NF4292_low_16
Description: NF4292
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4292_low_16 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 236; Significance: 1e-130; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 7 - 258
Target Start/End: Complemental strand, 48766759 - 48766508
Alignment:
| Q |
7 |
cgagtgagaagaaaatacgcaaaaaataagtgtttgtttgtgagatgcattttgatcatgcaaacaatcacatgactttatgcgggcagtaaaattaatt |
106 |
Q |
| |
|
||||||| || |||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48766759 |
cgagtgataacaaaatacgcaaaaaataagtgtttgtttgtgagacgcatttcgatcatgcaaacaatcacatgactttatgcgggcagtaaaattaatt |
48766660 |
T |
|
| Q |
107 |
tggttaaaatgtgattgttgcaaacaccgtgtggatttggtgtcttcttgcaaaagacaattgcttttgtttcaacctgcaattctttgcttaatcatta |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48766659 |
tggttaaaatgtgattgttgcaaacaccgtgtggatttggtgtcttcttgcaaaagacaattgcttttgtttcaacctgcaattctttgcttaatcatta |
48766560 |
T |
|
| Q |
207 |
gtagaaatgggaatcagattccctgctgttacagcagggtgctgtaactgat |
258 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48766559 |
gtagaaatgggaatcagattccctgctgttacagcagggtgctgtaactgat |
48766508 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 218 - 258
Target Start/End: Original strand, 25452584 - 25452624
Alignment:
| Q |
218 |
aatcagattccctgctgttacagcagggtgctgtaactgat |
258 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25452584 |
aatcagattccctgctgttacagcagggtgctgtaactgat |
25452624 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 216 - 258
Target Start/End: Original strand, 30198155 - 30198197
Alignment:
| Q |
216 |
ggaatcagattccctgctgttacagcagggtgctgtaactgat |
258 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30198155 |
ggaatcagattccctgctgttacagcagggtgctgtaactgat |
30198197 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 215 - 258
Target Start/End: Original strand, 38953515 - 38953558
Alignment:
| Q |
215 |
gggaatcagattccctgctgttacagcagggtgctgtaactgat |
258 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| ||||| |||| |
|
|
| T |
38953515 |
gggaatcagattccttgctgttacagcagggtgatgtaaatgat |
38953558 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 214 - 253
Target Start/End: Complemental strand, 26598389 - 26598350
Alignment:
| Q |
214 |
tgggaatcagattccctgctgttacagcagggtgctgtaa |
253 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
26598389 |
tgggaattggattccctgctgttacagcagggtgctgtaa |
26598350 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 216 - 255
Target Start/End: Original strand, 40799786 - 40799825
Alignment:
| Q |
216 |
ggaatcagattccctgctgttacagcagggtgctgtaact |
255 |
Q |
| |
|
|||||||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
40799786 |
ggaatcagattccctgttgttacatcagggtgctgtaact |
40799825 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University