View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4293-Insertion-4 (Length: 93)
Name: NF4293-Insertion-4
Description: NF4293
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4293-Insertion-4 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 84; Significance: 2e-40; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 84; E-Value: 2e-40
Query Start/End: Original strand, 1 - 93
Target Start/End: Original strand, 29147652 - 29147746
Alignment:
| Q |
1 |
tcaattgggttcaatagcctcaagattgaaaaccaaaatctta--tttttggagcttttatggttgaatgttaaagagatagatgttaatgtcga |
93 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29147652 |
tcaattgggttcaatagcctcaagattgaaaaccaaaatcttaaatttttggagcttttatggttgaatgttaaagagatagatgttaatgtcga |
29147746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University