View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4294-Insertion-3 (Length: 122)
Name: NF4294-Insertion-3
Description: NF4294
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4294-Insertion-3 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 94; Significance: 2e-46; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 94; E-Value: 2e-46
Query Start/End: Original strand, 8 - 120
Target Start/End: Original strand, 47301701 - 47301814
Alignment:
| Q |
8 |
tattattcataaatccctctttgatatcattcctggttcacaatacattttaacttgttgcttttccttg-tttttcttttccaaaggaagttgcttgct |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||| ||||||||||||||||||||| | |
|
|
| T |
47301701 |
tattattcataaatccctctttgatatcattcctggttcacaatacattttaacttgttgcttctccttgtttttttttttccaaaggaagttgcttgtt |
47301800 |
T |
|
| Q |
107 |
gatgttgttttcca |
120 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
47301801 |
gatgttgttttcca |
47301814 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University