View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4294_high_14 (Length: 364)
Name: NF4294_high_14
Description: NF4294
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4294_high_14 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 342; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 342; E-Value: 0
Query Start/End: Original strand, 18 - 359
Target Start/End: Original strand, 30832686 - 30833027
Alignment:
| Q |
18 |
gctggttgaatcatgttttctccaatctctgccacagtttcacctacagctcccaacacagtacttccaccatcagtaaccttctccatcttcacaacac |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30832686 |
gctggttgaatcatgttttctccaatctctgccacagtttcacctacagctcccaacacagtacttccaccatcagtaaccttctccatcttcacaacac |
30832785 |
T |
|
| Q |
118 |
catcttgaggttgttcattatttccttcaaagcttttttcagctatgttttcatttagctcttgttcttgtatactctttgtggaatcattggctttcac |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30832786 |
catcttgaggttgttcattatttccttcaaagcttttttcagctatgttttcatttagctcttgttcttgtatactctttgtggaatcattggctttcac |
30832885 |
T |
|
| Q |
218 |
agcgtctgcataagtagcatacactttgtttctttttcctccctcttgactttgtaaactttcatcagttttgttcatcttttctgcatgttggatttta |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30832886 |
agcgtctgcataagtagcatacactttgtttctttttcctccctcttgactttgtaaactttcatcagttttgttcatcttttctgcatgttggatttta |
30832985 |
T |
|
| Q |
318 |
gtttccccaatcacaccttgcttttttgctttgtctctctct |
359 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30832986 |
gtttccccaatcacaccttgcttttttgctttgtctctctct |
30833027 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University