View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4294_high_26 (Length: 250)
Name: NF4294_high_26
Description: NF4294
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4294_high_26 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 242
Target Start/End: Original strand, 44284844 - 44285086
Alignment:
| Q |
1 |
aacaatattgtttaaattttcatgtcaatattcagtctta-tagttcaaagaggttagtaagaaaaatatttcacttgcnnnnnnnatactttttataat |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||| |||||| ||||||| |
|
|
| T |
44284844 |
aacaatattgtttaaattttcatgtcaatattcagtcttaatagttcaaagaggtcagtaagaaaaatatttcacttgctttttttatacttcttataat |
44284943 |
T |
|
| Q |
100 |
ttcttaattaaaatattgatgccgccgattatagttcatacatactatgccgcacgagcacttcaaattaaaggtgtgtccggtaattgacaagcatact |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
44284944 |
ttcttaattaaaatattgatgccgccgattatagttcatacatactatgccgcacgagcacttcaaattaaagttgtgtccggtaattgacaagcatact |
44285043 |
T |
|
| Q |
200 |
agtgtcactctcacttgtaacactgctcaaccattcctttgct |
242 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44285044 |
agtgtcactctcacttgtaacactgctcaaccattcctttgct |
44285086 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University