View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4294_high_27 (Length: 242)
Name: NF4294_high_27
Description: NF4294
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4294_high_27 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 1 - 237
Target Start/End: Original strand, 30833245 - 30833485
Alignment:
| Q |
1 |
caataaaatgactacacattttgcatgcatatcaagtttcaggatacataatatccaagttaatt----cacttaaggcaggtactattttcaaataaat |
96 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||| |||||| |
|
|
| T |
30833245 |
caataaaatgactacacattttgcatgcatatcaagtttcaggatacataatatccaagttaattaattcacttaattcaggtactattttcatataaat |
30833344 |
T |
 |
| Q |
97 |
gttgataaggatggttatnnnnnnngcatagagctttcaatgaatcaatgtatgtatataaaagagaaagatagatatctagatgaggcattgatttaca |
196 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30833345 |
gttgataaggatggttataaaaaaagcatagagctttcaatgaatcaatgtatgtatataaaagagaaagatagatatctagatgaggcattgatttaca |
30833444 |
T |
 |
| Q |
197 |
tatagaaataaaaaccttattttgtgaagctcttttggcct |
237 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
30833445 |
tatagaaataaaaaccttattttgtgaaactcttttggcct |
30833485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University