View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4294_high_32 (Length: 210)
Name: NF4294_high_32
Description: NF4294
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4294_high_32 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 1 - 191
Target Start/End: Complemental strand, 43615325 - 43615135
Alignment:
| Q |
1 |
tccatgcagtccttcattactcctccttcattttcttacctgccccactgtgatttcactgttcttgaaatctaccctactcaagattgctcaggattgc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
43615325 |
tccatgcagtccttcattactcctccttcattttcttacctgccccactgtgatttcactgttcttgcaatctaccctactcaagattgctcaggattgc |
43615226 |
T |
 |
| Q |
101 |
accatgttgtttcagaattttgatctcagttagatcattcatgccctacatctacttatgggtcgattatattattcttcacacagtcaca |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43615225 |
accatgttgtttcagaattttgatctcagttagatcatgcatgccctacatctacttatgggtcgattatattattcttcacacagtcaca |
43615135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University