View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4294_low_19 (Length: 291)
Name: NF4294_low_19
Description: NF4294
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4294_low_19 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 79; Significance: 6e-37; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 79; E-Value: 6e-37
Query Start/End: Original strand, 86 - 164
Target Start/End: Original strand, 38940203 - 38940281
Alignment:
| Q |
86 |
actcactgatgaatcttcgttccgtttcaggttttagctcgaacatcttctcggtaattcgtcatcgctatttcttctc |
164 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38940203 |
actcactgatgaatcttcgttccgtttcaggttttagctcgaacatcttctcggtaattcgtcatcgctatttcttctc |
38940281 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 230 - 279
Target Start/End: Original strand, 38940347 - 38940396
Alignment:
| Q |
230 |
gtctgcacttgatatactgtatgaatattttggtttctatttctgatatt |
279 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38940347 |
gtctgcacttgatatactgtatgaatattttggtttctatttctgatatt |
38940396 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University