View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4294_low_23 (Length: 273)
Name: NF4294_low_23
Description: NF4294
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4294_low_23 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 16 - 258
Target Start/End: Original strand, 3611790 - 3612031
Alignment:
| Q |
16 |
atataaatatttagaaaatacagttttgttgttgacaattgcttcatggattgttcaacatttgaaataaactgataggaagatagttttcgatgcnnnn |
115 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3611790 |
atataaatatttaaaaaatacagttttgttgttgacaattgcttcatggattgttcaacatttgaaataaactgataggaagatagttttcgatgcaaaa |
3611889 |
T |
|
| Q |
116 |
nnnnnnnnnnnnnnngtcgatagaatcatattttctttaatttttgggtgatcgaaagttatctctttgcaaacccgctgcacttatagagcaactatcc |
215 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3611890 |
aaacaaaaaaaaaa-gtcgatagaatcatattttctgtaatttttgggtgatcgaaagttatctctttgcaaacccgctgcacttatagagcaactatcc |
3611988 |
T |
|
| Q |
216 |
tttttgtttatttcagttagattgaatataaaaagccttctct |
258 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3611989 |
tttttgtttatttcagttagattgaatataaaaagccttctct |
3612031 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University