View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4294_low_25 (Length: 261)
Name: NF4294_low_25
Description: NF4294
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4294_low_25 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 19 - 251
Target Start/End: Original strand, 26277616 - 26277849
Alignment:
| Q |
19 |
ggacatatggattgaaacggactcacttatggtggtgaaagctttctctcaacacattgcagttccttggactttgagagttagatggcgcaattgtata |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26277616 |
ggacatatggattgaaacggactcacttatggtggtgaaagctttctctcaacacattgcagttccttggactttgagagttagatggcgcaattgtata |
26277715 |
T |
|
| Q |
119 |
gc-ttaccgagactttttcttgtcgtttcacacacatccatagggagtgtaactctggccaatgagtaagttaagcatggtcatagtttacactcacaat |
217 |
Q |
| |
|
|| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26277716 |
gccttaccgagactttttcttgtcgttccacacacatccatagggagtgtaactctggccaatgagtaagttaagcatggtcatagtttacactcacaat |
26277815 |
T |
|
| Q |
218 |
ggtggacggatcccccacatttattttgcctttg |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
26277816 |
ggtggacggatcccccacatttattttgcctttg |
26277849 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University