View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4294_low_28 (Length: 251)
Name: NF4294_low_28
Description: NF4294
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4294_low_28 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 19 - 234
Target Start/End: Complemental strand, 26031395 - 26031180
Alignment:
| Q |
19 |
cagcaattttgacaattctaatcataaattcaatcacaaaaccatataaacaaatgaagaaaatcaaattaggagtgtagtaatcaaggttttaaacaaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26031395 |
cagcaattttgacaattctaatcataaattcaatcacaaaaccatataaacaaatgaagaaaatcaaattaggagtgtagtaatcaaggttttaaacaaa |
26031296 |
T |
 |
| Q |
119 |
ggtttgtgtacgcgatctgagcaacataacgcggcagcaattgaagccacattaatttcatttgactgcaattctctgtggtaccgcggtaccaaagatc |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
26031295 |
ggtttgtgtacgcgatctgagcaacataacgcggcagcaattgaagccacattaatttcatttgattgcaattctctgtggtaccgcggtaccaaagatc |
26031196 |
T |
 |
| Q |
219 |
acgacacaaccgttat |
234 |
Q |
| |
|
|||||| ||||||||| |
|
|
| T |
26031195 |
acgacaaaaccgttat |
26031180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University