View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4294_low_31 (Length: 240)
Name: NF4294_low_31
Description: NF4294
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4294_low_31 |
 | |
|
| [»] scaffold1099 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold1099 (Bit Score: 91; Significance: 3e-44; HSPs: 1)
Name: scaffold1099
Description:
Target: scaffold1099; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 17 - 131
Target Start/End: Complemental strand, 979 - 865
Alignment:
| Q |
17 |
aactaatagacttgttttggaagtttgaaccattttccaacaaccggtttcaaaggctttatggagtcataaggaggatagagatttattccaatgtaca |
116 |
Q |
| |
|
|||||||||||||| |||||||||||||| |||||||||||||| ||||||||||||||| |||||||||||||||||||||| |||||||||||||| | |
|
|
| T |
979 |
aactaatagacttggtttggaagtttgaagcattttccaacaactggtttcaaaggctttgtggagtcataaggaggatagagctttattccaatgtata |
880 |
T |
|
| Q |
117 |
gtaaattaaatatta |
131 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
879 |
gtaaattaaatatta |
865 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 48; Significance: 1e-18; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 146 - 197
Target Start/End: Complemental strand, 55496325 - 55496274
Alignment:
| Q |
146 |
ctccttctaatctcttagttaaaaccttcatcaacaacttatacaatctttc |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
55496325 |
ctccttctaatctcttagttaaaaccttcatcaacaagttatacaatctttc |
55496274 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University