View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4295_high_11 (Length: 262)
Name: NF4295_high_11
Description: NF4295
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4295_high_11 |
 | |
|
| [»] scaffold0189 (1 HSPs) |
| | |
|
Alignment Details
Target: chr3 (Bit Score: 233; Significance: 1e-129; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 21 - 257
Target Start/End: Original strand, 48883464 - 48883700
Alignment:
| Q |
21 |
aacggaagctttcttgcaaaagtatttgaccatatcgtcgccgagttcgttgaggatttcggcgttggattgatcttcatcgtcgtcaaggtcaatgtcc |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48883464 |
aacggaagctttcttgcaaaagtatttgaccatatcgtcgccgagttcgttgaggatttcggcgttggattgatcttcatcgtcgtcaaggtcaatgtcc |
48883563 |
T |
|
| Q |
121 |
atttctgtgtagttggtgttgttagcatctttgcttgaacctatgtgttccattgtggttgagaaatgaaaaattagggtttatggagaaagggttttgg |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48883564 |
atttctgtgtagttggtgttgttagcatctttgcttgaacctatgtgttccattgtggttgagaaatgaaaaattagggtttatggagaaagggttttgg |
48883663 |
T |
|
| Q |
221 |
tacaatttgccccttctcgcttaagcttcatctcact |
257 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
48883664 |
tacaatttgccccttctcgcttaagcttcttctcact |
48883700 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 24 - 125
Target Start/End: Original strand, 53014730 - 53014834
Alignment:
| Q |
24 |
ggaagctttcttgcaaaagtatttgaccatatcgtcgccgagttcgttgaggatttcggcgttgga---ttgatcttcatcgtcgtcaaggtcaatgtcc |
120 |
Q |
| |
|
||||||||| ||||| || ||||||||||| || || || ||||||||||||||||| || || || || ||||||||||||| |||||||||||| |
|
|
| T |
53014730 |
ggaagcttttttgcagaaatatttgaccatgtcttcacctagttcgttgaggatttcagcatttgatggtttttcttcatcgtcgtttaggtcaatgtcc |
53014829 |
T |
|
| Q |
121 |
atttc |
125 |
Q |
| |
|
||||| |
|
|
| T |
53014830 |
atttc |
53014834 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0189 (Bit Score: 72; Significance: 8e-33; HSPs: 1)
Name: scaffold0189
Description:
Target: scaffold0189; HSP #1
Raw Score: 72; E-Value: 8e-33
Query Start/End: Original strand, 22 - 228
Target Start/End: Complemental strand, 30223 - 30025
Alignment:
| Q |
22 |
acggaagctttcttgcaaaagtatttgaccatatcgtcgccgagttcgttgaggatttcggcgttggattgatcttcatcgtcgtcaaggtcaatgtcca |
121 |
Q |
| |
|
||||||||| | |||||||||||||||| |||||| ||||||||||||||||||||||| ||||||||| |||||||||||| | ||||| ||||||| |
|
|
| T |
30223 |
acggaagctcttttgcaaaagtatttgaacatatcttcgccgagttcgttgaggatttcagcgttggatggatcttcatcgttg---aggtcgatgtcca |
30127 |
T |
|
| Q |
122 |
tttctgtgtagttggtgttgttagcatctttgcttgaacctatgtg---ttccattgtggttgagaaatgaaaaattagggtttatggagaaagggtttt |
218 |
Q |
| |
|
|||| ||||| | ||||||| |||||||||||||||||||| ||||| | || || ||| |||||||||||||||||||||||| |||| |
|
|
| T |
30126 |
tttcagtgta------gatgttagcgtctttgcttgaacctatgtgatcctccat--tagtaaggagatggaaaattagggtttatggagaaaggatttt |
30035 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University