View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4295_high_17 (Length: 239)
Name: NF4295_high_17
Description: NF4295
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4295_high_17 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 39 - 223
Target Start/End: Complemental strand, 23920714 - 23920530
Alignment:
| Q |
39 |
gtatgtttaaagttccggtgataatttcaaaactcaatttaaaaggaattttgaactttttgtaaacaaacgtgtctttattttgctgcaatgcaatcta |
138 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||| |
|
|
| T |
23920714 |
gtatgtttaaagttccggtgataatttcaaaactcaatttaaaaggaattttgaactttttgtaaacaagcgtgtctttattttgctgcaatacaatcta |
23920615 |
T |
 |
| Q |
139 |
tgccctctctctccattgtaagattatttgtaaattttagtgattggtattgtgtagataaatactcctaactctgcacgaaatt |
223 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23920614 |
tgccctctctctcaattgtaagattatttgtaaattttagtgattggtattgtgtagataaatactcctaactctgcacgaaatt |
23920530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University