View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4295_high_18 (Length: 237)
Name: NF4295_high_18
Description: NF4295
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4295_high_18 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 22 - 237
Target Start/End: Complemental strand, 37809947 - 37809732
Alignment:
| Q |
22 |
tgtcattgtcaaaatgtgtttagtttgtgtcaacacttcagagatttagttatgggacccgaaaggtgttgagagtttcaaattagataactgcatggcc |
121 |
Q |
| |
|
||||||||||||||| ||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||| |
|
|
| T |
37809947 |
tgtcattgtcaaaatatgtttggtttgtgtcaacactttagagatttagttatgggacccgaaaggtgttgagagtttcacattagataactgcgtggcc |
37809848 |
T |
 |
| Q |
122 |
tgaacatttgttaaaaattagacacaactcaaattttaagaggaatgaaacaagattgaaaaggaacaaaatactttaaagtaattaatccactgcctag |
221 |
Q |
| |
|
| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||| |
|
|
| T |
37809847 |
ttaacattcgttaaaaattagacacaactcaaattttaagaggaatgaaacaagattgaaaaggaacaaaatattttaaagtcattaatccactgcctag |
37809748 |
T |
 |
| Q |
222 |
tcattctatgtcaagt |
237 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
37809747 |
tcattctatgtcaagt |
37809732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University