View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4295_low_11 (Length: 347)

Name: NF4295_low_11
Description: NF4295
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4295_low_11
NF4295_low_11
[»] chr2 (1 HSPs)
chr2 (5-256)||(37397503-37397754)


Alignment Details
Target: chr2 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 5 - 256
Target Start/End: Complemental strand, 37397754 - 37397503
Alignment:
5 agatgaaaagcagtcgagagtaccttggaaacactgcataccgtgataatcatcaaagtgtagggatccatgaagggttacattaccgattattatcagc 104  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||    
37397754 agatgaaaagcagtcgagagtaccttggaaacactgcataccgtgataatcatcgaagtgtagggatccatgaagggttacattaccgattgttatcagc 37397655  T
105 ggggtcatgtttgccaaagccttgtttgatcttggagcaagcaacaatttcattgcatgccttgcaatatctcatggataatgcaacactgcaaattcaa 204  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37397654 ggggtcatgtttgccaaagccttgtttgatcttggagcaagcaacaatttcattgcatgccttgcaatatctcatggataatgcaacactgcaaattcaa 37397555  T
205 ccaacaacaaaagttctgctatttacagatgcagcatcaaggataatggcaa 256  Q
    |||||||||||||||||||||||||||||||||| |||||||||||||||||    
37397554 ccaacaacaaaagttctgctatttacagatgcagtatcaaggataatggcaa 37397503  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University