View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4295_low_25 (Length: 217)
Name: NF4295_low_25
Description: NF4295
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4295_low_25 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 1 - 208
Target Start/End: Complemental strand, 1393608 - 1393401
Alignment:
| Q |
1 |
gccattgttctataattgagttgcacagctagtactgaaactagctatttatataatgttttgaaattggtttctgattaattataccaatggttttgga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1393608 |
gccattgttctataattgagttgcacagctagtactgaaactagctatttatataatgttttgaaattggtttctgattaattataccaatggttttgga |
1393509 |
T |
 |
| Q |
101 |
ttgtgaaaatgataaacattccatattaaccacatgagattggnnnnnnnnttgtatactggccttatcataatgcaccactatgtgaatgccacgtgga |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
1393508 |
ttgtgaaaatgataaacattccatattaaccacatgagattggaaaaaaaattgtatactggccttatcataatgcaccactatgtgaatgccacatgga |
1393409 |
T |
 |
| Q |
201 |
tgatgtcc |
208 |
Q |
| |
|
|||||||| |
|
|
| T |
1393408 |
tgatgtcc |
1393401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University