View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4296_high_24 (Length: 237)
Name: NF4296_high_24
Description: NF4296
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4296_high_24 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 1 - 220
Target Start/End: Complemental strand, 21571175 - 21570956
Alignment:
| Q |
1 |
ttggattatgcaatccgaataagtaaaatacgtgttaggattcactgggaannnnnnngcctgtgacggtatttttgaagtcaacttggaacttttgttg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
21571175 |
ttggattatgcaatccgaataagtaaaatatgtgttaggattcactgggaatttttttgcctgtgacggtatttttgaagtcaacttggaacttatgttg |
21571076 |
T |
|
| Q |
101 |
gtgttttttatgctaatatatattgctaattctcttcgcaccgaaagcaaagttgtcatttattccattaaaattgctcattataaaggtttgaaccatt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21571075 |
gtgttttttatgctaatatatattgctaattctcttcgcaccgaaagcaaagttgtcatttattccattaaaattgctcattataaaggtttgaaccatt |
21570976 |
T |
|
| Q |
201 |
tatggcttgaatatgattct |
220 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
21570975 |
tatggcttgaatatgattct |
21570956 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University