View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4296_high_28 (Length: 222)

Name: NF4296_high_28
Description: NF4296
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4296_high_28
NF4296_high_28
[»] chr6 (1 HSPs)
chr6 (24-204)||(1808795-1808975)


Alignment Details
Target: chr6 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 24 - 204
Target Start/End: Original strand, 1808795 - 1808975
Alignment:
24 gcactagttttattttcagattattttatttccttccatttcttcttcaaactatgagtcaatgttgtaaaaaggaattggagattgaaacgatgaggca 123  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1808795 gcactagttttattttcagattattttatttccttccatttcttcttcaaactatgagtcaatgttgtaaaaaggaattggagattgaaacgatgaggca 1808894  T
124 tgacgtggtttaaacggctcgaaccaagacaaaaccacgatcgaaccactgaaataaccgaaccatgccgaagagtggttc 204  Q
    || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1808895 tgccgtggtttaaacggctcgaaccaagacaaaaccacgatcgaaccactgaaataaccgaaccatgccgaagagtggttc 1808975  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University