View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4296_low_10 (Length: 330)
Name: NF4296_low_10
Description: NF4296
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4296_low_10 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 173; Significance: 5e-93; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 173; E-Value: 5e-93
Query Start/End: Original strand, 104 - 280
Target Start/End: Original strand, 42099772 - 42099948
Alignment:
| Q |
104 |
ttttatcaagttctacatctatttttgggtcttgtccatcataatttggtccaaaattcatatgattatgcatgagtaagtggtactcatgtttctgttt |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42099772 |
ttttatcaagttctacatctatttttgggtcttgtccatcataatttggtccaaaattcatatgattatgcatgagtaagtggtactcatgtttctgttt |
42099871 |
T |
|
| Q |
204 |
acttctatttataggtctgtttgcttgtatgattatatgatatcctttttcctggctattagttttcctaggttttc |
280 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42099872 |
acttctatttataggtctgtttgcttgtatgatcatatgatatcctttttcctggctattagttttcctaggttttc |
42099948 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 19 - 94
Target Start/End: Original strand, 42099670 - 42099745
Alignment:
| Q |
19 |
acatcacatatgtcctttgtcttcttctcttcaacagatctagctatattaatagggaaaaggtaaccatcattag |
94 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42099670 |
acatcacatacgtcctttgtcttcttctcttcaacagatctagctatattaatagggaaaaggtaaccatcattag |
42099745 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University