View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4296_low_16 (Length: 251)
Name: NF4296_low_16
Description: NF4296
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4296_low_16 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 65; Significance: 1e-28; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 21 - 169
Target Start/End: Original strand, 11453682 - 11453819
Alignment:
| Q |
21 |
tgatcggtagacactttcataaaatggattattaatattaatgggataattataaa-gcaacgccaattctaatataaaaactaataacatgttaaatag |
119 |
Q |
| |
|
||||||||||| |||| |||||||||||||||||||||| ||||||||||||||| |||| || |||||| |||||||| ||||||| |
|
|
| T |
11453682 |
tgatcggtagatacttctataaaatggattattaatattactgggataattataaaagcaaggctaattctcatataaaagctaataaa----------- |
11453770 |
T |
 |
| Q |
120 |
tcatgtgttaaatggactatgatctcaacgttatttcatgtaggttccaa |
169 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11453771 |
-catgtgttaaatggactatgatctcaacgttatttcatgtaggttccaa |
11453819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 164 - 243
Target Start/End: Original strand, 11454081 - 11454161
Alignment:
| Q |
164 |
ttccaacttaaggcannnnnnnaaaaaattaccattaatcatgcaatttgattcaac-cacaaaccatctcaacctatgct |
243 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
11454081 |
ttccaacttaaggcatttttaaaaaaaattaccattaatcatgcaatttgattcaacacacaaaccatctcaacctatgct |
11454161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University