View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4296_low_28 (Length: 222)
Name: NF4296_low_28
Description: NF4296
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4296_low_28 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 24 - 204
Target Start/End: Original strand, 1808795 - 1808975
Alignment:
| Q |
24 |
gcactagttttattttcagattattttatttccttccatttcttcttcaaactatgagtcaatgttgtaaaaaggaattggagattgaaacgatgaggca |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1808795 |
gcactagttttattttcagattattttatttccttccatttcttcttcaaactatgagtcaatgttgtaaaaaggaattggagattgaaacgatgaggca |
1808894 |
T |
|
| Q |
124 |
tgacgtggtttaaacggctcgaaccaagacaaaaccacgatcgaaccactgaaataaccgaaccatgccgaagagtggttc |
204 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1808895 |
tgccgtggtttaaacggctcgaaccaagacaaaaccacgatcgaaccactgaaataaccgaaccatgccgaagagtggttc |
1808975 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University