View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4296_low_30 (Length: 202)
Name: NF4296_low_30
Description: NF4296
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4296_low_30 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 59; Significance: 3e-25; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 59; E-Value: 3e-25
Query Start/End: Original strand, 101 - 188
Target Start/End: Original strand, 27744742 - 27744829
Alignment:
| Q |
101 |
ccaatttttacgatgattatgtgaaatgagnnnnnnntaacagatctgttatcttacttaatcaagagaaaaagagagcttgcctatg |
188 |
Q |
| |
|
||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
27744742 |
ccaatttttacgaagattatgtgaaatgagaaaaaaataacagatctgttatcttacttaatcaagagaaaaagagagcatgcctatg |
27744829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 39 - 88
Target Start/End: Original strand, 27743452 - 27743501
Alignment:
| Q |
39 |
atcatatctctaggattggtaacaaagaactatcagatcctataaacatt |
88 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27743452 |
atcatatctctaggattggtaacaaagaactatcagatcctataaacatt |
27743501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University