View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4297-Insertion-2 (Length: 57)
Name: NF4297-Insertion-2
Description: NF4297
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4297-Insertion-2 |
 | |
|
| [»] chr7 (3 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 53; Significance: 3e-22; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 53; E-Value: 3e-22
Query Start/End: Original strand, 1 - 57
Target Start/End: Original strand, 46328131 - 46328187
Alignment:
| Q |
1 |
tggaactgggttcaacccggatacccttgataacttgccctcttggctcacagaaga |
57 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
46328131 |
tggaactgggttcaacccggatacccctgataacttgccctcttggctcacagaaga |
46328187 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 33; E-Value: 0.0000000002
Query Start/End: Original strand, 1 - 57
Target Start/End: Original strand, 46323653 - 46323709
Alignment:
| Q |
1 |
tggaactgggttcaacccggatacccttgataacttgccctcttggctcacagaaga |
57 |
Q |
| |
|
||||||||| ||||||||||| |||| ||| || ||||| ||||||||||||||||| |
|
|
| T |
46323653 |
tggaactggattcaacccggacacccctgacaaattgccttcttggctcacagaaga |
46323709 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 29; E-Value: 0.00000006
Query Start/End: Original strand, 1 - 57
Target Start/End: Complemental strand, 46530726 - 46530670
Alignment:
| Q |
1 |
tggaactgggttcaacccggatacccttgataacttgccctcttggctcacagaaga |
57 |
Q |
| |
|
||||||||| |||||||||||||| | ||| | ||| ||||||||||| |||||||| |
|
|
| T |
46530726 |
tggaactggattcaacccggatactcctgacaccttaccctcttggcttacagaaga |
46530670 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University