View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4297-Insertion-4 (Length: 118)
Name: NF4297-Insertion-4
Description: NF4297
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4297-Insertion-4 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 117; Significance: 4e-60; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 117; E-Value: 4e-60
Query Start/End: Original strand, 1 - 117
Target Start/End: Complemental strand, 41010316 - 41010200
Alignment:
| Q |
1 |
ataactgccctgctataataagtttgagaacgttgttcctttctggagttaatttattaataggtaaagggaagcatcaagtggaaaagctagaaaaata |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41010316 |
ataactgccctgctataataagtttgagaacgttgttcctttctggagttaatttattaataggtaaagggaagcatcaagtggaaaagctagaaaaata |
41010217 |
T |
 |
| Q |
101 |
atttcgttcatagtttt |
117 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
41010216 |
atttcgttcatagtttt |
41010200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University