View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4297-Insertion-7 (Length: 124)
Name: NF4297-Insertion-7
Description: NF4297
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4297-Insertion-7 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 79; Significance: 2e-37; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 79; E-Value: 2e-37
Query Start/End: Original strand, 1 - 124
Target Start/End: Original strand, 34899971 - 34900095
Alignment:
| Q |
1 |
gagatgtacttttggtccttgtactttataaaaaataagttttgtttggccctcttcttcaaagaaaattgg-tttttggggtcat-tatttaac-ttta |
97 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||| |||||||| ||||||||||||| |||||||| |||| |
|
|
| T |
34899971 |
gagatgtacttttggtccttgtactttataaaa-ataagttttgtttggccctcttattcaaa-aaaattggttttttggggtcatctatttaactttta |
34900068 |
T |
 |
| Q |
98 |
tctgaattttggttttgtctcattttt |
124 |
Q |
| |
|
||| ||||||||||||||||||||||| |
|
|
| T |
34900069 |
tctaaattttggttttgtctcattttt |
34900095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University