View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4297_high_15 (Length: 271)
Name: NF4297_high_15
Description: NF4297
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4297_high_15 |
 |  |
|
| [»] scaffold1152 (1 HSPs) |
 |  |  |
|
| [»] scaffold0118 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold1152 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: scaffold1152
Description:
Target: scaffold1152; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 1 - 197
Target Start/End: Complemental strand, 1630 - 1434
Alignment:
| Q |
1 |
ttgttgctgctattgtttaatctgagttgctatgttgttgttgcagctgtttctaaggacaaggagggaacaaaagagagaagtgtgattgagggtgaag |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
1630 |
ttgttgctgctattgtttaatctgagttgctatgttgttgttgcaactgtttctaaggacaaggagggaacaaaagagagaagtgtgattgagagtgaag |
1531 |
T |
 |
| Q |
101 |
attgatgaggttgttgttgcagctatgttgatatggcatgaagattgactgagtttctatgttgttgttgcatctatgttgttgttagggttccttg |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||| |||||| |
|
|
| T |
1530 |
attgatgaggttgttgttgcagctatgttgatatggcatgaagattgactgagtttctatgttgttgttgcatctatgttgtagttggggctccttg |
1434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0118 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: scaffold0118
Description:
Target: scaffold0118; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 13 - 83
Target Start/End: Complemental strand, 42645 - 42579
Alignment:
| Q |
13 |
ttgtttaatctgagttgctatgttgttgttgcagctgtttctaaggacaaggagggaacaaaagagagaag |
83 |
Q |
| |
|
|||||||||||| ||||||||||||||||| | |||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
42645 |
ttgtttaatctgggttgctatgttgttgtt---gttgtttc-aaggagaaggagggaacaaaagagagaag |
42579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 8 - 40
Target Start/End: Complemental strand, 11316273 - 11316241
Alignment:
| Q |
8 |
tgctattgtttaatctgagttgctatgttgttg |
40 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
11316273 |
tgctattgtttaatctgagttgctatgttgttg |
11316241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University