View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4297_high_26 (Length: 231)
Name: NF4297_high_26
Description: NF4297
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4297_high_26 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 18 - 221
Target Start/End: Original strand, 23935949 - 23936170
Alignment:
| Q |
18 |
cttcttatcttgtctgttacacaattcatgacaaatgaacattgagaaggctcaatcttaattttcatcatgttggcagagacggatctagcatatgaca |
117 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23935949 |
cttcttatcttgtctgttgcacaattcatgacaaatgaacattgagaaggctcaatcttaattttcatcatgttggcagagacggatctagcatatgaca |
23936048 |
T |
 |
| Q |
118 |
t------------------taattataaattttgggatcaattcaaattcatcattaagcttaattacattaagtcaaaccaagggccaaatgaagccta |
199 |
Q |
| |
|
| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
23936049 |
tgatgtggatgtagccacataattatgaattttgggatcaattcaaattcatcattaagcttaattacattaagtcaaacaaagggtcaaatgaagccta |
23936148 |
T |
 |
| Q |
200 |
acactttccctctttgatgatg |
221 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
23936149 |
acactttccctctttgatgatg |
23936170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 149 - 192
Target Start/End: Original strand, 22818674 - 22818717
Alignment:
| Q |
149 |
catcattaagcttaattacattaagtcaaaccaagggccaaatg |
192 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||| |||||| |
|
|
| T |
22818674 |
catcattaagcttaattacattaaatcaaaccaagggtcaaatg |
22818717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University