View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4297_low_23 (Length: 253)
Name: NF4297_low_23
Description: NF4297
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4297_low_23 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 13 - 237
Target Start/End: Complemental strand, 5697523 - 5697299
Alignment:
| Q |
13 |
taggggaaatgagagaaattatggattgctcttgataaacaattgaggataatttattggttaatttttgtaactctcttgttcttgatataaaaggtta |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5697523 |
taggggaaatgagagaaattatggattgctcttggtaaacaattgaggataatttattggttaatttttgtaactctcttgttcttgatataaaaggtta |
5697424 |
T |
 |
| Q |
113 |
gggtggaaattagggtttgcttatgttgatctcatttatggatccgataattgctctctccgtaggcaatttgggttgaactgcgaaaacaatttttgtc |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
5697423 |
gggtggaaattagggtttgcttatgttgatctcatttatggatccgataattgctctctccgtaggcaatttgggttgaactgcgaaaacaatctttgtc |
5697324 |
T |
 |
| Q |
213 |
tgttttttccttctactctatttat |
237 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
5697323 |
tgttttttccttctactctatttat |
5697299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University