View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4297_low_24 (Length: 252)
Name: NF4297_low_24
Description: NF4297
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4297_low_24 |
 | |
|
| [»] scaffold0205 (2 HSPs) |
| | |
|
Alignment Details
Target: scaffold0205 (Bit Score: 102; Significance: 9e-51; HSPs: 2)
Name: scaffold0205
Description:
Target: scaffold0205; HSP #1
Raw Score: 102; E-Value: 9e-51
Query Start/End: Original strand, 138 - 247
Target Start/End: Complemental strand, 20886 - 20777
Alignment:
| Q |
138 |
atcacaatggctaacagtaatttctgcaacacgcacgcacttagtgtcgtgttgaataattcaggataaataacattgttaaaccttttgtacaatatat |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20886 |
atcacaatggctaacagtaatttctgcaacacgcacgcacttagtgtcgtgttgagtaattcaggataaataacattgttaaaccttttgtacaatatat |
20787 |
T |
|
| Q |
238 |
tcatctcact |
247 |
Q |
| |
|
|||| ||||| |
|
|
| T |
20786 |
tcatttcact |
20777 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0205; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 13 - 49
Target Start/End: Complemental strand, 21000 - 20964
Alignment:
| Q |
13 |
ttatgtcgtgaattgttgatattgtcacctcaaggaa |
49 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
21000 |
ttatgtcatgaattgttgatattgtcacctcaaggaa |
20964 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University