View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4297_low_27 (Length: 241)

Name: NF4297_low_27
Description: NF4297
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4297_low_27
NF4297_low_27
[»] chr7 (1 HSPs)
chr7 (1-226)||(24300947-24301172)


Alignment Details
Target: chr7 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 1 - 226
Target Start/End: Original strand, 24300947 - 24301172
Alignment:
1 tgtaatgatcttaaatgttgagctacaatcattagcttcaaaatttatgtccagctcatgggatttgagctttgtagggttttaaagcaagtatagtgct 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
24300947 tgtaatgatcttaaatgttgagctacaatcattagcttcaaaatttatgtccagctcatgggatttgagctttgtagggttttaaagcaagtatagtgct 24301046  T
101 tctgttttggacttcttggttaattgctttcccaccttattgctagcttcacttcattaacttaacatgggtagagttttagctcatatcttatgcttca 200  Q
    |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
24301047 tctgttttggacttcttggttaattgctttcccaccttgttgctagcttcacttcattaacttaacatgggtagagttttagctcatatcttatgcttca 24301146  T
201 aggttcacttgattaacatcgatatt 226  Q
    ||||||||||||||||||||||||||    
24301147 aggttcacttgattaacatcgatatt 24301172  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University