View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4297_low_29 (Length: 233)
Name: NF4297_low_29
Description: NF4297
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4297_low_29 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 19 - 219
Target Start/End: Complemental strand, 45508153 - 45507953
Alignment:
| Q |
19 |
gcaaacgtgttttgtaccatatttcaaaagtaacatttatgcacttcgatatgatcgatatctggctagctaaattagtgtggttatggcacggccataa |
118 |
Q |
| |
|
||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45508153 |
gcaaaggtgtttggtaccatatttcaaaagtaacatttatgcacttcgatatgatcgatatctggctagctaaattagtgtggttatggcacggccataa |
45508054 |
T |
|
| Q |
119 |
actttgtaggagtagtttacaatccccttggtttgcacgctaaccaagttattcgaactgtgaagaaacttgattgctcatttctggttcagtctacaaa |
218 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45508053 |
actttgtaggagtagtttacaatcaccttggtttgcacgctaaacaagttattcgaattgtgaagaaacttgattgctcatttctggttcagtctacaaa |
45507954 |
T |
|
| Q |
219 |
g |
219 |
Q |
| |
|
| |
|
|
| T |
45507953 |
g |
45507953 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 19 - 219
Target Start/End: Original strand, 19846307 - 19846507
Alignment:
| Q |
19 |
gcaaacgtgttttgtaccatatttcaaaagtaacatttatgcacttcgatatgatcgatatctggctagctaaattagtgtggttatggcacggccataa |
118 |
Q |
| |
|
||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19846307 |
gcaaaggtgtttggtaccatatttcaaaagtaacatttatgcacttcgatatgatcgatatctggctagctaaattagtgtggttatggcacggccataa |
19846406 |
T |
|
| Q |
119 |
actttgtaggagtagtttacaatccccttggtttgcacgctaaccaagttattcgaactgtgaagaaacttgattgctcatttctggttcagtctacaaa |
218 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19846407 |
actttgtaggagtagtttacaatcaccttggtttgcacgctaaacaagttattcgaattgtgaagaaacttgattgctcatttctggttcagtctacaaa |
19846506 |
T |
|
| Q |
219 |
g |
219 |
Q |
| |
|
| |
|
|
| T |
19846507 |
g |
19846507 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University