View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4297_low_33 (Length: 217)
Name: NF4297_low_33
Description: NF4297
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4297_low_33 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 9 - 195
Target Start/End: Original strand, 40866236 - 40866422
Alignment:
| Q |
9 |
atagaaaagatcatcaaagtgcagaagggcctaactctttcaattacttgtgtgccaagccatgtacttcatattttcaattcagtacaactcaaaattt |
108 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40866236 |
atagataagatcatcaaagtgcagaagggcctaactcttccaattacttgtgtgccaagccatgtacttcatattttcaattcagtacaactcaaaattt |
40866335 |
T |
 |
| Q |
109 |
gatttaacctacctgttaggtgagcaaaggtcaaatgactctgataattaaatgtctctgcttgtctatgttggctaatgatattaa |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40866336 |
gatttaacctacctgttaggtgagcaaaggtcaaatgactctgataattaaatgtctctgcttgtctatgttggctaatgatattaa |
40866422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University