View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4298-Insertion-4 (Length: 226)
Name: NF4298-Insertion-4
Description: NF4298
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4298-Insertion-4 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 226
Target Start/End: Complemental strand, 29982268 - 29982043
Alignment:
| Q |
1 |
tcaatgtcttatttgattgtactgactttgccacaaaatggtttatcctgcaaaaatttatgcgtaatacctttcttgcctcattgaaaatcatatcttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29982268 |
tcaatgtcttatttgattgtactgactttgccacaaaatggtttatcctgcaaaaatttatgcgtaatacctttcttgcctcattgaaaatcatatcttt |
29982169 |
T |
|
| Q |
101 |
caatctttcccttttgaaattatcaaggctatctcatataccatgtgattttggtccaaatcgaggtaagggtctttgaaatcatatgccctataagaag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29982168 |
caatctttcccttttgaaattatcaaggctatctcatataccatgtgattttggtccaaatcgaggtaagggtctttgaaatcatatgccctataagaag |
29982069 |
T |
|
| Q |
201 |
aaattgattattgaatccgaatgata |
226 |
Q |
| |
|
|||||||||| | ||||| ||||||| |
|
|
| T |
29982068 |
aaattgattactcaatcccaatgata |
29982043 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 54; Significance: 4e-22; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 89 - 178
Target Start/End: Complemental strand, 42105101 - 42105012
Alignment:
| Q |
89 |
aatcatatctttcaatctttcccttttgaaattatcaaggctatctcatataccatgtgattttggtccaaatcgaggtaagggtctttg |
178 |
Q |
| |
|
|||| ||||||||||||||||| | | |||||| |||||||||||||| |||||||| |||||||||||||||||| |||||||||||| |
|
|
| T |
42105101 |
aatcgtatctttcaatctttcctatgtcaaattaccaaggctatctcatttaccatgtaattttggtccaaatcgagataagggtctttg |
42105012 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University