View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4298-Insertion-8 (Length: 112)
Name: NF4298-Insertion-8
Description: NF4298
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4298-Insertion-8 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 108; Significance: 1e-54; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 108; E-Value: 1e-54
Query Start/End: Original strand, 1 - 112
Target Start/End: Complemental strand, 327246 - 327135
Alignment:
| Q |
1 |
ctggtaaataccataacagtgcagaatcctcaagaagagatagtgttggataatgaatgctttgcacagttctatgaggattgaatgaaattgagaaata |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
327246 |
ctggtaaataccataacagtgcagaatcctcaagaagagatagtgttggataatgaatgctttgcgcagttctatgaggattgaatgaaattgagaaata |
327147 |
T |
|
| Q |
101 |
ctcattggtcat |
112 |
Q |
| |
|
|||||||||||| |
|
|
| T |
327146 |
ctcattggtcat |
327135 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University