View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4298_high_20 (Length: 219)
Name: NF4298_high_20
Description: NF4298
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4298_high_20 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 169; Significance: 8e-91; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 20 - 200
Target Start/End: Complemental strand, 22738929 - 22738749
Alignment:
| Q |
20 |
attcacctatcctttcagcatcaacagtcattaagttgatgatttcaccgctgctgtatccctctttcgattgacacgaaagggtcaaacctttagcata |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||| |
|
|
| T |
22738929 |
attcacctatcctttcagcatcaacagtcattaagttgatgatttcaccgctgctgtatccctctttcgattgatacaaaagggtcaaacctttagcata |
22738830 |
T |
 |
| Q |
120 |
gattattgataccaacattgattgtatcctaacaccaacctgttggaacttaaacatccagtgcttctgagaaagacattc |
200 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22738829 |
gattattgacaccaacattgattgtatcctaacaccaacctgttggaacttaaacatccagtgcttctgagaaagacattc |
22738749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 120; E-Value: 1e-61
Query Start/End: Original strand, 20 - 188
Target Start/End: Original strand, 22728054 - 22728228
Alignment:
| Q |
20 |
attcacctatcctttcagcatcaacagtcattaagttgatgatttcaccgctgctgtatccctctttcg------attgacacgaaagggtcaaaccttt |
113 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||| |||||||| |||||||||| ||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
22728054 |
attcacctatccttacagcatcaacagtcattaagttaatgatttcgccgctgctgtgtccctctttcgtttttgattgacacgaaagggtcaaaccttt |
22728153 |
T |
 |
| Q |
114 |
agcatagattattgataccaacattgattgtatcctaacaccaacctgttggaacttaaacatccagtgcttctg |
188 |
Q |
| |
|
||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||| |||| |
|
|
| T |
22728154 |
agcatagatcattgataccaacattgattgcatcctaacaccaacctgttggaacttaaacatccattgcctctg |
22728228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University