View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4298_high_21 (Length: 204)
Name: NF4298_high_21
Description: NF4298
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4298_high_21 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 164; Significance: 7e-88; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 164; E-Value: 7e-88
Query Start/End: Original strand, 19 - 194
Target Start/End: Original strand, 2978841 - 2979016
Alignment:
| Q |
19 |
tgaatatcttcatcagttcaaatcctttgattttttgtctgtcagctacattgaaacaatcattcacatagtctgaatgtcctcttgttactgctttgaa |
118 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2978841 |
tgaatatcttcgtcagttcaaatcctttgattttttgtctgtcagctacattgaaacaatcattcacatagtctgaatgtcctcttgttactgctttgaa |
2978940 |
T |
 |
| Q |
119 |
acaatcattcacatttaattcctgcgttagtgatgtttatgtcactttctttctttcaacaatttttcttctcact |
194 |
Q |
| |
|
|||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2978941 |
acaatcattcacatttaaatcctgcgttattgatgtttatgtcactttctttctttcaacaatttttcttctcact |
2979016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University